CBrugiaQ_3420


Sequence

>CBrugiaQ_3420 (5 EST) Length=183 TTTGTTATTTTTTTTTAGTCCTTTTTTGTTTTTTGTTTTTTTTNCTATTTTTGTTTTATTAGGTTTTTTTGATTATCCTT GGTGTGGTTGTTTTTTTTTTTNAAANCCTTTAANTTTGNTTCCCTANCCTTTAAAAATTTTNTTAATTTANGGTTTAATT TTTTTCCCAAAGGTTNGGGNNGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3420: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8390331795698AA199955SW3ICA1990SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8963301890010AA255407SW3ICA2447SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9214451923296AA280435SW3ICA2490SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246071926209AA283515SW3ICA2639SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10859972153581AA441703SW3ICA2518SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 12:24:25 on Fri 17 Nov 117.