CBrugiaQ_343


Sequence

>CBrugiaQ_343 (2 EST) Length=633 CCGGAGCGCTCAGGATGGCTCGCTCGGTGGCCGTGATCTTCCTGGTGCTCGTCTCAACGGCGGGACTGTACGCTATCCAA AGCACCCCTAAAGTGCAAGTGTACTCCCGCCACCCACCGGAAAATGGGAAAACAAACTACCTGAACTGCTACGTGTCTCA GTTTCATCCACCTCAAATCGAGATCGAACTGCTGAAGAATGGAAAGCCGATACTAACAGAAGGAAAAGTACAGTACTCAG ATCTGTCCTTCAGCAGGGACTGGACCGGCTATCAACTGGCTCACACTGAATTCACCCCTACTGCAACTGACTCCTATGCC TGCAAAGTCACACACATCAATCTCAAGGAGCCCAAGAAGTGTCACCTGGGGAACGACACAGTGTAATCAACCACCATGGA AGTCTCAGGAGACCATTAGTTCCAATTCAATGCCCGATTTCAACTGCTGATATGCTACACAATTTACGCACACAGGCAAG AAATTAGGAATGTTGCACACCATCTCCATGGTAAGTAACAATAAATGCCAATAAGCATGTCTGTCCAAAAAAAGGAGACT ACCTCCTAAATTTCTTGAAACAATAAGCTCCATGATTTTTCTGATCCGAAACCTTAGGGAAAACTTTGATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_343: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855791876983AA246175SWMFCA1662SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855801876984AA246176SWMFCA1663SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:31:41 on Sun 19 Nov 117.