CBrugiaQ_3435


Sequence

>CBrugiaQ_3435 (2 EST) Length=442 GAAATGCCTGTATCGGGATGAACTTGCTTCAGGACACGGTAGATATATGCAGAATACGACTCCTTGCGTCGAGATTTCCG CTTCTTATCGCTACCGCGAACTTTCTGCGATTTCGCAGCTTTTTTGGCTCCTTTAGCAGATGGTTTTGGTGGCATGTTAA CAACACACGAGATCTCAAACTTGGGTAATTAAACCCGGAATTCCGGGTTTAATTACCCAAGTTTGAGTGATCTAATTAGT TAGGATGGGAAAACCAAAAGGTATACGTACGCGCTCGGGAAATTGAAGACACGATCGGCCGGCTCGGCGCTTGGAACGAT AAGGATACAAAAGGCTCGATTTGGGGACTCGGTGCAGCTCGCAGATCCGAAGCATTGTTCTCGAAAAGTTGGTGTGAGCT ACGACGTACTCACGTATCGTAGTTCAGTGTCGATATAGATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3435: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576431193280N52114KJ4SLB176T3JHU93SL-BmL4 (JHU)
8811071871091AA241427MBL2SJ9F4T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 15:35:16 on Fri 24 Nov 117.