CBrugiaQ_3469


Sequence

>CBrugiaQ_3469 (7 EST) Length=611 AGGGCGGATTGGGNNCCGGGCCCCCCCNCGAGNTTTTTTTTAAACCAGGAGGNCANTTTCCCCAAAAAAAAATTCTCTCT CTTTTCATNAAAAANAAACCACATCGATGTAGCGCAGCACACTAATATAAAAAAACTATTTACATGTTCCACAACCCTGT TTAACTCCGGAGTAATTTTTTAAAATAAAAATAGTAAAAAAAATTTATTAAATTCCATCCCCAAGAAAATATTAGTAAAA AACAAAAAAAAAATCAAATACTAAAACAAAATTTCCGAAGNCTTATCTTTGTAATATTACAATCAATAATTTTTAATAAA AAAAATAATTCAAATAAAATATAAACAAAAAAATTGCTAAAAACTCCATTCATACTTGAAAACAATAAAAAAACAAATCA CTTACGCTACTTTGATGCCATCACGCTAAGGCTGCCATTTAAAAAAATCATAGAGCGAGACACTTTAAATGGCAACCTTA AAAAAAAACCTAAGTTTTTAATAAACATTTAACAACAAATCTAGTTCAAAAATAAAATTAAAAAACAAAANTAATACAAA ACAAAAAAAAGTTACCAAAATAAAAAGAATAAATTAATTAAAAANTTACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_3469: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
309257924258H48206SW3ICA301SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3658041019977H64216RRAMCA011SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4458971182914N44395SW3ICA1263SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6462691502099AA032127RRAMCA211SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7566281673253AA118204MBAFCE6D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002761737659AA161629MBAFCF7D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10751212113598AA430802RRAMCA1522SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:25:11 on Thu 23 Nov 117.