CBrugiaQ_347


Sequence

>CBrugiaQ_347 (2 EST) Length=1019 CTGAAACGTTGTCTCTAATTTCGCTATTAGTATGGCCGACGAAATAGCTCGCGTGCAACAGTACGAGTATCGACAGAATA GTAACCTTGTGCTGCAAGTCGATTTCAATTTCACAGATCGTCGTGGTCGCGATGAACCTACCGGTGAAGTTATGCCACTC ACTAAGGAGGTTTTGGCTGGTGTTAAAATGGGCGACAAGTATCAGCGAGCCAAAGCACCTGCAATTGACACTAAAAAAGC AAGAAAAAAAAAGCGAACTGATGCAAGTGTCACAGGGGAATAGTACGACTTCGCACACTTTGTTGGGAGATTCAAATACG GAACTAATGGGCTTGTACAAGCCAAGAAACGCAAGAAACAAGGCAAACCTATGAAGCAATATTGGCTTATATACAAGATG CCGTCGGAGATCAGCCACGCGATATTCTGTGTGGTGCAGCTGATGAAGTCTTAGCAGTATTGAAGTCCGACAAAATTCGT GAGAAAGATCGTAAGAAGGAATAGAACTTCTTCTTGGATTGTTGACGGATGAAAGAATAGCTGTATTGATTAATCTTGCC AAGAAAATAACAGATTTTTCAGTCGAAGACAAAAAAGGGAAATTTGACAATCAAGATGAAATAGATGAAACAATCGGTGT AAATGTACAGTTCGATGATTCTGATGAGGAAGCTGAGGGCGACNAAGGTATGGAGGAAGAAGTAAAAGAAGAAGGTTCAG CTGGGGAAGATGAAGGTGGTGTTGAAGCTGTTTTTGAAGAAACACTTAAGGCTCGATATGTTGATGAGGACGATGAGAAT GCGGGTGGTGAACGAAAAGGAAATCTGCATGCTCGCGATATAGATGCGCATTGGATTCAGCGGTCACTCTCAAAATTTTA CAAAGATCCAATTGTTGGCACCAGCCAGAAAATTTAATGAAATTGCCTGCCAAGTTTTTTGAAAGGGAGGCCTCCCGAAT GAACCCGTTGATTTGGTTGAANAAATCCCANCCTGGGTTAATTTAATTNGCCTTTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_347: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214951923346AA280485SWMFCA2149SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12617592392955AA585543SW3D9CA124SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:29:51 on Sat 18 Nov 117.