CBrugiaQ_348


Sequence

>CBrugiaQ_348 (7 EST) Length=630 CCAAGTTTGAGGGTTAAGCGTTGGATTTATTCAATATGGCTGAACGTGGAGGTTTTCGAGGTGGATTTGGTAGTGGCGAA CGGAGTGGTAGAGGTGGTCGTGGTGGCGGTGAACGAAGTCGTGGTCGTGGTCGAGGTCGGGGTGGACGTGGTGGAAGAGG TGGAAAAGAAGGTGATAAAGAATGGGTTCCAGTAACGAAGCTGGGTCGTTTGGTTAAAGACCGAAAAATCACCTCGCTTG AAGAAATTTACCTGAACTCATTACCTATTAAAGAATATGAAATTATCGATATGTTGTTATCTAATTTAAAGGATGAGGTA CTAAAAATAATGCCAGTGCAGAAACAAACTCGTGCTGGTCAGCGTACACGCTTTAAGGCTTTTGTTGCTATTGGAGATCA CAATGGGCATGTTAGGCTTGGGAATGAAGTGTTCAAAAGAAATTGCTACAGCTATTCCGTGGTGCGATCATTGCTGCGAA ATTTATCAATCATCCCCTGTTACGGCGCCGGAATATTGGGGTTAACCAAAATTGGCCAACCACATACCCTACCCTGCAAG GTCACCCGAAAATGTGGTCCATGCCGGTGCTCTATCCCGCCCCCAAAAGCCCGGTTTTTTTCCGCACCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_348: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291595902127H30971SW3ICA220SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6807051547268AA054861SWMFCA811SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8428391799504AA203761SW3ICA2035SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9140911912015AA273080SWMFCA1892SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10481392064786AA406794MBAFCZ4G04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10989582168128AA454459MBAFCX1H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814462655566AA675860MBAFCW5F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:21:0 on Fri 24 Nov 117.