CBrugiaQ_3480


Sequence

>CBrugiaQ_3480 (2 EST) Length=326 CAGCGAAATTGAATTCCCCGTGCAGATGCGGGGTACCCGCGGTTAGACGAAGAGACCCCGTGCACCTTTACTATAGCTTT ACATTGGTATTAAAAATGTGATGTGCAGAATAGGTGGGAGACTTTGAAGTTATGGCGCTAGCTATAATGGAGTCAACCTT GAGATACCACCCTTTACACTTTTGATACCTAACTATGTTTCATTATCTGAAACTAGGACATTGTATGGTGGGTAGTTTGA CTGGGGCGGTCGCCTCCTAAAGAGTAACGGAGGCGTGCGAAGGTAAGCTAGAGCTGGTCGGAAATCAGCTTGATAGTATA ATGGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3480: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299955914324H39243SWAMCA073SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10483042064951AA406959MBAFCZ7C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:19:32 on Sun 19 Nov 117.