CBrugiaQ_3508


Sequence

>CBrugiaQ_3508 (2 EST) Length=257 AATAACAGAAATCAGGAGTTTCTATGACTGCTCGAGGAAGGATGCAATCGGTAAAATTAAGAAAAATCCGATAATGTGAA ATCAGGTGCGATGTAGCAATATCTCTACACACTCGTCATGCAGGATAAGAAGGCTGAAATGAGCATCGTGCACTGCTCAG TAAGATGATATGATGTATCATACATATCGCATGATTGTGCATTGTGTTATTCGATGCATGTTCATGAGACTATAGCATCT GAAAAAGATCGTTATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3508: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061551115060H97288KJ4SLB007SLJHU93SL-BmL4 (JHU)
8678971850662AA228572KJ4SLB414T3JHU93SL-BmL4 (JHU)


Date: 10:3:40 on Fri 24 Nov 117.