CBrugiaQ_3514


Sequence

>CBrugiaQ_3514 (2 EST) Length=264 AATTACCCAAGTTTGAGGGGTAGTAGGTGAAATTTTTNNGAAAATCATCAAAGATGTTGATCGCGAACAAAAAATCGGTA AGCTATTTATGAGTATTTGAACAAAGAAGGCTATGTGTGCGAAGAAAGATATAATTTTAAACACACCTATATACCTAATG TACAATTGAGTATAAGCTGCAGAGTCTCTTCCGGATACGTAAGACATTCAGGCGCATCTATGATACGATGAAGCATGATA TTCACATTCACATTCGCGTATTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3514: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576581193295N52129KJ4SLB249T3JHU93SL-BmL4 (JHU)
10312322042868AA389882KJ4SLB310T3JHU93SL-BmL4 (JHU)


Date: 14:7:22 on Mon 20 Nov 117.