CBrugiaQ_3531


Sequence

>CBrugiaQ_3531 (2 EST) Length=265 TTTAATTACCCAAGTTTGAGCCTCTGATATTGAACATAAAAAAGTTTCAAAAAGGTTAGTAATAATCGTGCTATATGCTG AACAGTAAACTGAATCATTTATAAACATGCTGCGCTACCTATAAAACGAGAAACCCATTACTCTTGACAACACCGAGTAT CCGCATCGATACTCTCACTTCTCAAACTGTCGTCGTGGAGAAGTTGTAGACGAGCTTATCATGAGCAAGAAGATCTTTCT GAGACATCGCATCGCAGAGTACTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3531: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576211193258N52092KJ4SLB036T3JHU93SL-BmL4 (JHU)
8679051850670AA228563KJ4SLB431T3JHU93SL-BmL4 (JHU)


Date: 16:31:55 on Fri 17 Nov 117.