CBrugiaQ_3588


Sequence

>CBrugiaQ_3588 (2 EST) Length=243 CTCTTGTCCGGATCCGCTCATTATTGTAGTTCGGATATTGGAATGATTTGCAACATTTTTTTAGTTTCTCTTAGCTATCC CTGTTGTTTAATAATGGTAGATTTGCTGTAATTGCTCATTTCCGAAAGGAATAGAATTTTCTTATGTTGTTAAATTATCT ATTCAGGGAAAATTTGATGCTTATAGCGATTCCAGAATTCGTTTCATTCGCTTAGTTAAATTAAATAAACGTAGAAGAAA CTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3588: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002611737644AA161608MBAFCF7C01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212582344752AA570862SWMFCA2627SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:52:18 on Fri 17 Nov 117.