CBrugiaQ_361


Sequence

>CBrugiaQ_361 (10 EST) Length=632 GGATGGACGGCCCCCCGGGTTTTTTTTTTTTTTTCAATGTAACAAATTATCCGTAGCAAGTGGTAAAATCAAACAATTCG ATAACAGTCTTTCATTTAGTCNAAACAGGACAAANGATATATTGCGGTTTTATTAACNTCCTTTCTTNTTGAACACACCA ACAGTGCGACCTTTTCTACCTGTTGTCTTAGTGTGCTGTCCGCGAACACGAAGTCCCCAATAGTGTCGAAGCCCTCTGTG CAGACGAATTTTCTTCAGTCTTTCTAAATCTTCACGAAGCTTATTATCAAGCGATGTAGACAACATCTGAGAATACTTCC CATCCTTGATATCCTTCTGCCTGTTCAGAAACCAATTCGGGATTTTATATTGGCTGGGATTTTGCATTACTTGTTGCAAT TTCTCCAGATCTTCTTCCGATAGTTCGCCAGCACGTCGATTAATATCAATATCAGCTTTTCGGCAAACAACAAATGCAAA ACGTCTGCCGACACCCTTAATAGCAGTGAGTGCGAATGGTACTTTCCTGTTGCCATCGATATTCGTGTTCATAACACGAT GAATATGTTGAAACTTCTCCGGTATTATTAACGACATCCTGCACCTTTCTCTTCCGTTCCTCAAACTTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_361: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217700808522R47635AS3ISB020SLBrugia malayi infective L3 JHU93SL-BmL3
4449791172361N43478AS4SLC813T3Brugia malayi L4 JHU93SL-BmL4
6363801486145AA022363SWMFCA487SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6676541537134AA051906SWMFCA865SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8809461870930AA241664MBL2SJ2E8T3Brugia malayi second stage larvae JHU96SL-BmL2
8809861870970AA241678MBL2SJ8B7T3Brugia malayi second stage larvae JHU96SL-BmL2
11536602246874AA508997MBAFCX6A09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212382344732AA570842SWMFCA2604SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12354172369512AA584959SWMFCA2681SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12652362402607AA588944KJ4SLE036T3JHU93SL-BmL4 (JHU)


Date: 7:32:11 on Sun 19 Nov 117.