CBrugiaQ_363


Sequence

>CBrugiaQ_363 (3 EST) Length=1011 GGGACCGGTTTTTTTTTGGGCCCCAAGTATCCGCAAGAAATTCAGCTAGGGGAAAAAGGGGGTTTCCCATCGGCATCCAT TCGTTTCAAAAACAGGATCAACGCATCCGATATAATTCTTCAACCCTTTCAAGGTTCAGAGAAATTATAAAGTTTCTCGA TTTCTGGTAAAAAGATGGTATTCAACTCATCATAACTCCAGTAACCATCACCATTTTTATCATGCAAACCAAAAAGTGTT GTTGGATCGNATGTATCTTTATCAAGCTTGTCAGTATCTTCCCAAACCTTTTTTAATTGATTACGACTTCCCGGATGCTT CAATGGCTTATGCTTATTATGCAGACGCCGCTGTTCTTCCATCTGCTGTATGTAATGTTCTCGTTCCGTTTGAATCATTT GTGCCATTTTATGATCTTCTTCAGCTTTTTTTTTCATTTCATATTGTTTGAAGTCTTGTTTTCGCCAAGGTTCCAATTCA TCCATATCAGCTACAACTTGGACGAACAAGTTTGCGCAGGTCCTCTTGGCTGAATGTTTCCCAGTTATTGAAATCCAAAT GCTCCGGTATTTNGATATTATCAGTAGCACCACCATCTGCATCCAGCTGATCCTTTATTTTCTTGGCTCCCAGACGTTGT AATTCCAATATTCTTCGGCTTTTGGCTAGTTGTTCAATAATATGGGGTTCTAACTTGTGGACCATTTCTGCTATTTTGCC ACCCCGCATTTCCTCTTGCGTCATATTCTGCATAGCTTCTTTCCACTGCGGTGTCGCTTGCAAGATACTGAGCACGGTTT CCAGATACTTCATATATTTCACATATTTCGCTATCTCTTCTTTCTGCATCACTTCCCTCCGTTGTTGTTCCCTGGTCCCA CTGTCGTTGTTTGTCAACACTCTGTAGTTCATCTACCGTGTCGCGGTTTGGTGGAGCAGCATCTATGAATAACGATATTA ATACACAGAACGATAGCAACAACTGCGAAAACATCAGTTAGGTTGTCGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_363: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
325129951339R88403TNPIBM3001Brugia malayi infective L3 JHU93SL-BmL3
6807121547275AA054868SWMFCA818SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8854961876900AA246092SWMFCA1386SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:2:50 on Tue 21 Nov 117.