CBrugiaQ_3646


Sequence

>CBrugiaQ_3646 (2 EST) Length=242 GAGATCTTTAAATTAACCCAAGTTTGAGGATGGAAGAAAAGGTAGTGGAAACTAACGCACAACTGGAGTCGACGACGTGG GATTGGCCCTTACAGCACAACGATAGGTATTAAAGTAACCAACACGAATGATAGTTTAAGTCGGTTGGATGCATCATCTT CACGCCAAGAAATCGAGGTAAGTGTCTGGCATATCTGTACTACCTCGAACTATACTCGCATATGATACTATGAATACGGA GA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3646: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061361115041H97269KJ4SLB058T3JHU93SL-BmL4 (JHU)
4157251122668H98447KJ4SLB146T3JHU93SL-BmL4 (JHU)


Date: 15:40:46 on Fri 24 Nov 117.