CBrugiaQ_3653


Sequence

>CBrugiaQ_3653 (2 EST) Length=349 ACGAGAANTAAATGAAAAGCTNACTTGACAACGATGACAACATGCCTGATGTGATGCCGGNAATGAGCATGAGCTCGAAG TGTACATGTCAATGGATNACAGCATGGATCAAAGCACTGATCTCGCATTCCACAATCANATTCCTCCTCACCATCAATAA TACCATTACCACACTGTTGTAATGTTGATGCCTATTAAAATGATCACAAATTAAAAAAAAAAAAAAAAAAACTCCCGATC ACAATCCATCGATCACAATCCATCGATCATAATCCATCGATCATAATTCATCACACGAACAGTTCATAATGTTATTTCTC CATTTCTGTGACAGCTATCACATATTGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3653: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3918051079824H89394RRAMCA053SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8962981889978AA255375SW3ICA2413SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 12:45:35 on Tue 21 Nov 117.