CBrugiaQ_3665


Sequence

>CBrugiaQ_3665 (2 EST) Length=263 CTCGAACTACTGCACTATCTCATCCGAACGAGTGATTGATGTGACTGGTACGTACATGACATGATCTCTCTGTATCGCAT GCACATCGACTCCTCAGCGACATGTAAGTTCAGCTGAGCTGACCGATATCGATACTTTCTAATCGCGATCCGCATTTGAT ACTGCTTTTCCAATTCATACGACACTTTTCTTCGGCACAACAATCTTCGATGAAACTTACGGCATCTTTTCCTCACAAAT ACTGCTTAAAAGAAAAAAGAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3665: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061601115065H97293KJ4SLB026SLJHU93SL-BmL4 (JHU)
8679061850671AA228564KJ4SLB432T3JHU93SL-BmL4 (JHU)


Date: 4:32:49 on Sat 25 Nov 117.