CBrugiaQ_3683


Sequence

>CBrugiaQ_3683 (4 EST) Length=251 ATTTTGAGGTGTGCCATAATATTTATTACATTATTTCATCAATACCAATTAAACTTTAGACCTTTTACTTCCTTAATTTA AAGCAAAATTAAAATTTGCGGGAAAAATGATGAAGAACAAAAGCAGCGAGTATATATAATAAAATTAAATTTTGAATCTA ACATTACAGAGTAAACTCGAATAGGTCGGCTAAACAGAATCGTTCATCAAGTTTGTGCGCAAAAGCTGCCGGATCACTAT TGCCGTTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3683: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8962961889976AA255373SW3ICA2409SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10481462064793AA406814MBAFCZ4G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11938522315004AA547803MB3D6V1B02T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
11939232315075AA547874MB3D6V2B09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 9:56:21 on Fri 24 Nov 117.