CBrugiaQ_3684


Sequence

>CBrugiaQ_3684 (29 EST) Length=1226 TAATTACCCAAGTTTGAGGAAATAACATGGTTTTTAGAGGTATTGCGGGAGAAACTTTGCTGCTGATCGCAGTAAATCTC TTAGCAATATCACTAGTGGATGCAGTTCCCTATGGATACGCTAGACCTTCACCCCTAAAAGGTAATGGTGCAGAAAAACC ATATGATGGCGGACCTGGACCGAGCGATGATGTAGGATATTACCAGAGTGTCAAAGATGGACAAGATGAAAGCAGCAAAT ATTACGGCGGTAAAAAAGATATGATGCTACCCCAACCACGCGCACCTCCTAGCAGAGGATATGAAGCCATTAGCAAAAGA GGCCAAATGTCGTATGCACGTCCGAGTTATAGCTAGGAGCACTGCCATTTCTCGCTTGCAAATTCAAAATCGTCTATCAT CTACTTCGTTTACACCGTCTGTCTTTAACTTTCTGCGAAGAACGTGAATTATTTCGATAAGTAATTTCATCTCCACTCTC AAGGACAAACCAAGTTTCTTCCTGTGTTATTATCACTGTTTTGAAAAAAATAATAATTTTACGTTATTAAACAATCAACC ATATAATTTACGACTGCGAATGAATGCTTTGTATTCTGACGCAACTGTGACGCAATACGATCCAAATCTTTACGACCCTG CTTAGTCAATATGCGTCCCTTACCATCAGGATCTTTTTCTACCCATTTGATGGCTTCCAATGTTTGCAGAGCTTTACGTA TGACCGAACCAGATGACCTCACAAAATGATTCGGTGTAACACCATGTCGCTTATTACCACCATATACACGTCTCAATGCA CCAACACCGGTAGGTGAACGAATGTACAAACGACGTGCAATGCTTGCTGTTCGGATGTAATACCAGTCGTTATCAACCGG TGCTAATTCCTTATTTTGACCCAATTTGACGACATCAGACCAATCTGGCACTCTTACTTTGCCACTTTTCTTCAGGAAAC CCGCAATTTGACGTACAATTTCATGCTGATCAACGTCCTTAACGCTTGTCGGTTTCACCATATTCCTCAAACCTCGTGCC GAATTCGGCACGAGTCCTTTCCGCAAAATTTACTGCATTGGTGATTTACAGTGATTAGCTCGTATTTGATAAGCAAAAAA AAGGGTTCAAAAAGGAAAAAATAGAAAAAAAAANTTGATAAAATTATAAAAAATGAACAAAAAGTGGAGAAAAATTAAGC AAAAGTGGGAAGAAATTAAGCAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_3684: (29 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435283
1435289
1435290
320221945422R86436SWAMCA341SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4448821172264N43381AS4SLC464T3Brugia malayi L4 JHU93SL-BmL4
4449211172303N43420AS4SLC524T3Brugia malayi L4 JHU93SL-BmL4
4449231172305N43422AS4SLC561T3Brugia malayi L4 JHU93SL-BmL4
4449381172320N43437AS4SLC586T3Brugia malayi L4 JHU93SL-BmL4
4449961172378N43495AS4SLC867T3Brugia malayi L4 JHU93SL-BmL4
4958881442879N89549KJ4SLB273T3JHU93SL-BmL4 (JHU)
5406871313865W32835RRAMCA1213SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5594191345240W51527AS4SLC568T3Brugia malayi L4 JHU93SL-BmL4
6722161537163AA051998SWAMCA1478SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7062381592656AA072555MB4SLD036T3Brugia malayi L4 JHU93SL-BmL4
7473601660970AA109474MBAFCE2G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7523261668310AA114414MBAFCE4E11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002911737674AA161644MBAFCG0B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196461763827AA180635MBAFCG1D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196491763830AA180638MBAFCG1D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196851763866AA180570MBAFCG2F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196871763868AA180585MBAFCG2F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197641763945AA180727MBAFCG3H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8678861850651AA228545KJ4SLB339T3JHU93SL-BmL4 (JHU)
10312362042872AA389886KJ4SLB317T3JHU93SL-BmL4 (JHU)
10429852055216AA401615SWAMCA1673SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10429922055223AA401622SWAMCA1701SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10482532064900AA406908MBAFCZ6F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483292064976AA406893MBAFCZ7E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813822655502AA675796MBAFCW4H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:13:53 on Fri 24 Nov 117.