CBrugiaQ_3690


Sequence

>CBrugiaQ_3690 (3 EST) Length=353 TTTCACTATAATTCATTTATTATCATTTACTTCAAAATATTTACATGTTAAAATCAGATATAGCGAGTATTTTAGTTTGA ACGGAAGATGAAAATGATGATGATAATATTAACCTTTAATTTGGTTAATTGACAATAATATTATTATTAATATCACTTGT CATTATTATTGCTTTCATCATCGTTACTACAGATTGTATTCGATGGGCAAATTCTTGCGGCGAACCATGCCATCGCCCTG GAACCATTCGCGGCGGAACTGTTTCGACAGAGCCATCCGGTGTGTTTGTCCATTAAGATGGAAAAACGATCGTTGAAGAT GTCTTCCTCTATGCAACGAAAAATGGAGATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_3690: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451541182181N43601RRAMCA092SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7159401620797AA080702RRAMCA283SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987812167951AA454282RRAMCA440SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:22:16 on Wed 22 Nov 117.