CBrugiaQ_3702


Sequence

>CBrugiaQ_3702 (5 EST) Length=422 ACTTACACCGTTCCCGTTCCTTCTGTGGATCTGGGTACAATAAATCTCGTGCTAACGGCATCTTTATATCAGACGGAATA TAATTATCTAAAAGTATTCGTTAACCTCAAACTTGGGTAATTAAACCAGGAATTCCGGGTTTAATTACCCAAGTNTGAGG ACAATCTTCGGTATCATTCAGATTTACTTGATCTGAAAACTGTGCGCTCTTTCTGCTTCAGTATTGATTGCTAGGAGAGA AGTAGCGTAAAAATGAGAGACAAGTGGCGTNAAAAGCGTATGCGTCGGCTGAAGCNTAAGCGAANGGCAGCGAAGAAGTG ATTAATGTTGGAAGGTGGGGAAGGAGCCCTGAAATATTCTGTGGATTGCAGTCACGCTTCAGTTTAAATCTGGATCTCGA TACTCATCTCTCATCTTGATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3702: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061591115064H97292KJ4SLB023SLJHU93SL-BmL4 (JHU)
5594451345266W51553AS4SLC645T3Brugia malayi L4 JHU93SL-BmL4
8986551893260AA257770MBL2SJ3A2T3Brugia malayi second stage larvae JHU96SL-BmL2
8987651893370AA257854MBL2SJ4C12T3Brugia malayi second stage larvae JHU96SL-BmL2
13736192629534AA668035MBL2SK3B07AT3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 0:41:34 on Sat 25 Nov 117.