CBrugiaQ_372


Sequence

>CBrugiaQ_372 (3 EST) Length=572 NCAGAGGAATAACAGTTTTGAACATTTNGGAATCCCAAACACCAACATTTCATGGCCAACTTGCGATGTAGCAGGATTAT GATCAAAGAGGTGTCATCGGAGGTGAAATTTTTTTCCGGTATAGCCGGAGATGCAAATTTTGCAGCAATAAATGCATTTG TGTTTGCCGGATTACCAACGACAATGATCTTAGTTGTTGGCTTAGCATATTTAGCAAGAGCTATTCCTTGTGATTTGAAA ATTTTGACATTTGCAGAAAGTAAATCTTTGCGCTCCATACCTTGCTTTCTTGGCATTGCACCGATAAGAAAAGCATAATC GATACCTTTGAATGCTTNTTCCTCTTTTACAGTCACAACAACTTCTTGTAAGGTTGGTAAAGAGCAATCTTGCAGCTCAA ATTGTACACCTTCAAGAGCTTGTAGCATTGGAGGTATATCGAATAGTACAAGAACAATTGGCGTTTCAGGACCAAAAACA TCACCCTTAGCAATTTGCAAAACAACAGAATATCCAATTTGACCCGCTGCGCCGGTTACGAGAACACGAAGTACCATTAT TTTTGATGCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_372: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061821592600AA072474SW3ICA1609SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7092511613925AA074021SW3ICA1680SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272451634890AA089411SW3ICA1778SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:54:23 on Sat 25 Nov 117.