CBrugiaQ_3745


Sequence

>CBrugiaQ_3745 (3 EST) Length=222 CTCGAGCGGCACGAGATTTTTTTTAAGTCCTTTTTTGTTTTTTGTTTTTTTTTCTATTTTTGTTTTATTAGGTTTTTTTG ATTATTCTTGGTGTGGTTGTTTTTTTTTTTTAATTCCTTTAAATTTTTTTTCCTTTTCTTTTTTAGGGGTTTTGGGGTTT TTTTTGTTTTCCGGGGTTTGGGGGGGCTAGGTTTTTAATGGTGGCCTAATGGTTTTTTTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3745: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6462671502097AA032125RRAMCA208SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7523061668290AA114394MBAFCE4A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10776922130875AA433398SWAMCA1614SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:56:30 on Tue 21 Nov 117.