CBrugiaQ_3760


Sequence

>CBrugiaQ_3760 (2 EST) Length=220 TGCCAANAGGTGCGAGGAAACTATATGATTGTGTGCACAATGATTGCACATGTAGACGCTATCATCGAAAATTTTGTCGA GATTTTCAACTAAACGTAATATCGTCTTATATCAACAACACAACTCTCAATTAGAAAAATACTGTACCAATTACTATTTG TATTCGCAGCATATTCATATCTATCAATCGCACAAGGGAAACTCTCGAACTAAATCATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_3760: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
259980862593H00100AS3ISB322SLBrugia malayi infective L3 JHU93SL-BmL3
259981862594H00101AS3ISB323SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 12:34:52 on Tue 21 Nov 117.