CBrugiaQ_3769


Sequence

>CBrugiaQ_3769 (2 EST) Length=219 GGGGAAATGAATAATCAGGAAGCTGTTACTACTGCTCAATCAAATTCTGTTTCAACTAGTCGGAGTGAATTTGTTGATTT ATCTCCAAGCAATGAAGATGCAGCAGTTACGAGTAATATTAGTGCACAAACAGTTCAATCTTTTGTGGAAGACGGCGGAG GATGAAGAAGCAATTAATTCTGATTCGTTAATGTTTTCTGGATCAATCATAATTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3769: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217650808472R47585SWAMCA108SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
217651808473R47586SWAMCA109SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 3:45:22 on Sun 19 Nov 117.