CBrugiaQ_377


Sequence

>CBrugiaQ_377 (5 EST) Length=891 GTTTAACGACTCCATCTAACTCTATAAACGGCATCAGTCACAAATATCTCCCGTAAAGTTAATCGGGTCTCAAAAAAGTT TTCGAATGCAGAAGATTCTGATTGCCGCCAAAATCGGGAATAAAGATGTCACTGTATTGGATCAAAAGCCTCCATACAAC AAATTTCCTCTTGGAGTAACTCCAGCAATGGAAGACAACAGCATCACGTTATTCGGTGCAGACGCAATTATGCTTCATTT GACAGGCGAAACAATGAAAGGAGCAAATTGCTCGGAAATGTTGCAGTGGATGCAGTGGTCTGAGGGGCAGCTAATACCAA GTGTTTTAGGTTATGTATTACCAAGTGTTTCAGTTGCTCATATTGACAGTGAGATCTTGGAAGCAGCAAAGACAGAATTG CTTACGCAGCTGAAGTGTTTGGATAAACTGCTTTTAACAAAAACTTTCCTAATCGATGAAAGGATGTCTCTTGCTGATAT TTCTGTAGCAATGGATTTACTTCCTGCTTATCAATATGTCTTGGACGAAGCGATACGTACGTCATTAATTAATGTCAACC GTTGGTTCAGAACCATAATTAATCAAAAATCTGTTAAAGATATCCTTGGTGAAGTGCAGTTTGCCAAAAAAGCATCCAAA TTTGACACCACGAAATTCAAAGAATTATCTGCAAAACTATCCAAAGAACGTACGGCTCATAAAGATGAAAAAAGCAAGGA ATTGCGCGGAAAAAAAAACAAAGGGCAGCAGGAGGAAGATAAGAAAACCAAACGAGCAAAAAATGAGGACAATGAACCAG ATGCTGCTGAAGAAGTNTTAGCTCAAGAGCCGAAATCAATTGAACCTTTCTCTGCTACGCCTAAAGGAACTTTTGTGATG GATTCCTTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_377: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4255581141659N27311SWMFCA230SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7523011668285AA114389MBAFCE3H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8855951876999AA246178SWMFCA1682SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10988602168030AA454361MBAFCX0F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247272539370AA626983MBAFCW2B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:53:48 on Sat 18 Nov 117.