CBrugiaQ_3779


Sequence

>CBrugiaQ_3779 (3 EST) Length=216 CTCGTGCCGCTTTCACCGGCTGTAAGTAAGGTGCGCGGTTATCGCTATCAGTTCTGCTCGGTGTATGTGAATGTTCACTT TCTGCATACAAAAAAATGAAAAAANTANAAAAATTAAANCAAAAAAATGACAAAAAATATGAAAACCCTCCAGAAAAAAG AAAAAAAGAAAAGAAAGAAAACCCCTTTAAAAAGATAAAAAAGAGATATATCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3779: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196101763791AA180599MBAFCF7H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196531763834AA180642MBAFCG1E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814062655526AA675820MBAFCW5B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:34:12 on Thu 23 Nov 117.