CBrugiaQ_38


Sequence

>CBrugiaQ_38 (2 EST) Length=697 NGGGTTTNGTAGTAAGGCATTCNANATAATTGGCGCAAATNCATTTTCGGGTNCAAATTCCTTCCACNGTTTTCCTTCGG TACCCGTAGAACAGATTTNAGCCATAGGTGTTCCCCTGGNAAAGCAGCATTTATGGAAGGTAGTCAAAAACCATTTTCAA TTCGGATCTTCAGCTGCTTTATTTATTTCAACACAGTATTTGGAGTACGCTCAGTTTCCAAAGTCGCTTGCTCTAATTTA CTGTTATGAAAAAAAACGGGCCAGNCAGGGCCCAACCAACATTCTTCAAAGGTGTTATGAGGAACGCACTGCACATNAAA ACGCATTATGATCTCTGGAAGTATATGAATCAAATCTTGCACCGATCTTCTCCAATTCTGTCTCCAATTACTGTTTGCGA TCGTTTCTTTGTTCCACGGTACATCATGTGTTCCAGGAAATTTGAAATTCCATTGTTTGCTTCATTTTCAAAACGACTTC CAGAATCGATCCAAACGCCAACAGCGATGGTTGGTCGTTGGTTAGTTTCACCGACAACACGAAACCCATTCTTCAAGGAT GTAACTTCGGGCGCAGAAATACTACTCAATACATCACGTGCTGCATAAACTGCTGTAGCTCTGAGCGAAAGGTGTAAGCC ATTGAAGGCGAACAGTGTTTTGGAAGTAGTGCACAACAGTGAACGCCATGACATCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_38: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10777182130901AA433424SW3ICA2657SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12618922393088AA585676SW3D9CA433SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 9:9:42 on Sat 18 Nov 117.