CBrugiaQ_3830


Sequence

>CBrugiaQ_3830 (2 EST) Length=248 GATCGTTGTGCTGCGTATTACTTCCATCATCTATTACTTCTGTCTTGAATACCGTGCATTAAGCGCGTTTGCGCACAATA TCATCGCCACCAATCATCTTCCACCTCCGCATTAATGCGCAGTCGATATCATTTTCTCGCGAGATGAATCAAGTGATTTA GTGAAATCACAACCATCATCAGCTTTACTCGTGCCAGCCATCATTGACACACGCTTGTAAAACCTAAACTTTGGGTAATT AAGCCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3830: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157121122655H98434KJ4SLB129T3JHU93SL-BmL4 (JHU)
8988031893408AA257633MBL2SJ4H5T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 11:53:29 on Mon 20 Nov 117.