CBrugiaQ_3847


Sequence

>CBrugiaQ_3847 (4 EST) Length=534 GAGTGGGCATTTACGAATGTTTCGAAAGTGGTGCATTGATCAAAATGTAAAAAGGTTTGGCTAGCAATTCCTCACTGCTT TTTTACTTCTTTTGAATTTAGACGAAGGAGTGCACTTAGGCGTCTACTGCTTTTTTTACTGCACTTCACCACTTATAGTG CAGTAATGGTGCGTACACAACGTTGAATACTTCCTGATGCATTTTTTTTTTCCTGTCCTGGCGTACACCAAGAACAGGTC CATCCTTCCCTTGGTTTCTAAAAACTGGGGGAGAGATCCTGCGAAGTTTAAGATCTGCGTTTAAAAAAAAAACCACAGCT TATACCGGGATTGGGTGGCCCCGGGTGACACATTTTTTTCTTTTCCTCTCGAACTTCTGCAGCAGTTTCTAATTCTGCAC CGATTGATCCATTTCTACATCTACCAATCAGCAATCACTGCCACAGATTTCTGTACATTATTACTTTCATAAGTTAAATC AGCATTTTATTGAATCATTACTACATCGGGATTTCAGTAAAGGTTTGTGTTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3847: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425361164684N41086SWMFCA314SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8197081763889AA180671MBAFCG3A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162632199404AA471640MBAFCX4H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813382655458AA675752MBAFCW4D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:19:12 on Fri 24 Nov 117.