CBrugiaQ_3864


Sequence

>CBrugiaQ_3864 (3 EST) Length=349 GGAGGGGAATTTATAAAACAGAAATCCCGTCTAATACCGAAATGATGACAACAAGGAAAAGTTCAAATTAAACATGAAAA TTTTTAAAGATCAATGACTTGAGTCTTTTTTCCTCTGTCATATACTGCTTTAGCAAAGCATCCACGTTTGTAATCGCTGG ATCCCAAAAATACCTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCCGCACGAGGCTAAGAAGCATTGCTTTCCCTC TCCACTTCTTTTTCTCTTTCGTCTCTTTTTTCCTTCCTGATCCCTTACACGATAATTATTTTTCTTCTATTTCTGTTGTA TTTCAATCAGCAATAAAATACATTTACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3864: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596411349147W51718SWAMCA614SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801211382122W59842SWAMCA786SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7497141663804AA111828MBAFCE2H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:32:23 on Sat 18 Nov 117.