CBrugiaQ_3866


Sequence

>CBrugiaQ_3866 (2 EST) Length=208 AATTTCTGGACAATGATCTTAAATACTTATTTGAATGTCTGTGCGAAGATTCAAGATATCTGCACAGTAGGAAATCACTG GAGAGATGAGTTCGATGATGATCGGGTGGTTTTGTTCCCTTTAGTTTATGTCGCTATAGCCTTATGTTACTTTATTGTCA CTGTTTTTGTTAAATTCATTTCCGAATAAACACATAAATGCTAACATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3866: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197231763904AA180686MBAFCG3C01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8497241809175AA210646SWMFCA399SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:2:21 on Sun 19 Nov 117.