CBrugiaQ_3871


Sequence

>CBrugiaQ_3871 (2 EST) Length=221 GAGTCGGTTTAATTACCCCAAGTTTGAGAAACGAGTATTGATGTAGATGCTTTAACAAGTCGCTGCTCGACTTCGTATGG ATCGAGCATACTGTCCGTATAGCAATTTACTGAAGGTCGTGCTTTATAACCAAAGATGTAATATCCAAGAGAATCTCGAG ATCGCATCTATTGCGCAATTATCGGATCAGAGTCAGTACCTGCGCTCTAGAAGTATCTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_3871: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4061681115073H97262KJ4SL040T3JHU93SL-BmL4 (JHU)
8678741850639AA228533KJ4SLB306T3JHU93SL-BmL4 (JHU)


Date: 23:22:46 on Mon 20 Nov 117.