CBrugiaQ_3892


Sequence

>CBrugiaQ_3892 (6 EST) Length=252 TCGATAAGCTTGATATCGAATTCAAATCANCCATTGTATGTTTTCGAGCCACAAGTATAGCCAAAGTTTTTCCAATATGT TCGTGTAATCGATATAGAGCCAACGATGGGTCGTGGTCAACAATATGCGCACTTTCTGAGAGGCGTTCCGCCAATATGCG ACAGCGTGCATGCAACTCTTTCGATGCCATTCAGTTGTGCATTCTCAAACTTGGGTAATTAAACCGATCTAGAGCGGCCG CCACCGCGGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3892: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281252890009H21314AS3ISB224SLBrugia malayi infective L3 JHU93SL-BmL3
281860890044H21349AS3ISB105SLBrugia malayi infective L3 JHU93SL-BmL3
7566741675191AA118250KJ4SLB188T3JHU93SL-BmL4 (JHU)
8712871854359AA231945AS3ISB105T3Brugia malayi infective L3 JHU93SL-BmL3
8982721892877AA257401MB4SLM2E3T3Brugia malayi L4 JHU93SL-BmL4
9164331917053AA275418MB4SLY1C10T3Brugia malayi L4 JHU93SL-BmL4


Date: 13:32:51 on Fri 24 Nov 117.