CBrugiaQ_3906


Sequence

>CBrugiaQ_3906 (37 EST) Length=2881 TTCCCTTCNGTTCTCCGNNAATTATCAGATTTTAATTTGGAAAAATGAGGAACATATTGATATTATTGATTGTCTTATTA ATAATCGTAAATGTAGAGTCGTTTGGTTGGGGATACTCATATTATGGTGGACAATCACAAGATTTGGGAGATTTCCCAGC GTTTAATCCAGGGTCAGCGATCGCTGGTGCTGTACTGGGCAAGAAGAAATAATTAATATTTTTACTTGAAAACATTGATA AAATATTTTCGTATTCATTTCAATTCTATTTGGTTTATTTTTAAGTGTTGAAAAGGTCATACGTTTATCAGAATATCATT GTATTTGGAAGATTTAATGATATCAAATGCAAATATGTCGATTGCTTAATAAGTATCGATTAATTATTTTTATATTTGGA ATATTAAACTATCGNTTATTCATTCNCAAAATTGATGCTCAAGTTCAGATAGAGTAATTTCATCAGAAATAAATATCTGG CATTGATTGCAATGATGAGAGTTGTATTTCAATTTCATCTCTAATTGCATTGAATGATGCTAATGCTGCAAGCTCTTTCT CCAACTGCATCAGCTAACCGTTTTAGAATATCATCTCAGTTGTGCCAGTAATCTATTACCATCCTCACGTAACTTATTAC CTTCATCATTCATCGGAATATTTTCTAGCAAAATTTCAAGTTGATGTTTNTTTCCTTCAAGCTCACTTAATGCATTATTT TGTTCTTCAACTGTTTGCAATGGTATTTGTTCCATTTCATTTATATAATGTTGCACATTTTCGTCGATCAAATTTATCTC CGCAGTTGTGGAATATAATCCGGCACGATCGGGCAATTTCTCCTTCTTATCATCAAGTGCATTTCTGTAATCGTACCGAA TCACTGCAGCACAAAGATCATCACTTATTAATGCACGTTTTACCATACCTTCCGAATTATGTAATTTTCCTTCTAGTTTT TCAACTTTTCCTTTCAATTTTCGCAAATTTTCAGTTAATTCACCAATGCTCATCAATTGTTGTGATGGCTCATTTATGCT ATCAACTCCAATAACATCATCACCAATTGAAGTTATTGTCGATAGTATTTCATGAACATTTTGCATCAATTCTTGCTCCT TTTTCACTCGTGCCGAATTCGGCACGAGGTTTGAGTGGCTTTCTCTCCGAATAAGCAGCGCATCGTCAACTATGCCGATC ACACGTGTTCACGCCCGTCCTATTTATGATTCACGTGGTAATCCAACCGTCGAAGTTGATTTGACCACCGACAAAGGTAT TTTCCGTGCGGCTGTACCAAGTGGTGCTTCAACTGGTGTACATGAAGCACTTGAACTTCGGGACAATGATAAAGCTGTGA ATCATGGCAAAGGTGTTTTGAAAGCTGTAAGAAATGTCAACGAACATATTGGACCTGCTCTAGTTGCTAAGAATTTTTGT CCAACTCAACAACGTGAAATCGACCATTTTATGCTGGAACTCGATGGAACCGAAAATAAAGCAAAACTGGGTGCCAATGC AATTTTGGGTGTTTCATTGGCGGTTTGCAAGGCTGGTGCAGTGCATAAAGGTATGCCGTTGTATAAGTATATAGCAGAAT TGGCTGGTACCAAACAGATTGTTCTGCCAGTTCCTGCTATGAATGTTATCAACGGTGGTTCTCATGCTGGTAATAAACTG GCAAATGCAGGAATTTATGATCATGCCTATTGGAGCTAGTTCATTCAGTGAAGCAATGCGCATGGGTTCTGAAATTTACC ATTACTTGAAGGCAGAAATCAAAAAACGATACGGTCTCGATGCAACAGCAGTGGGTGATGAAGGTGGTTTCGCTCCTAAT ATTCAGGATAACAGGGAAGGTCTTGATTTGTTGAATACAGCAATTGCAACAGCTGGATACACGGGAAAAGTAGCAATTGC TATGGATTGTGCCGCATCAGAATATTATATGGAATCAGCTAAGCTGTACGATTTAGACTTCAAAAATCCAACCTCGGATA AAGCCCAGTGGAAAACTGGTGATCAAATGATGGAAATCTATCAATCCTTCATTAAGGAATATCCAGTTGTATCGATTGAG GATTGGTTTGACCAGGATGACTGGGAAAATTGGACCAAAGCATTGGCTAATACGCATATTCAAATTGTTGGCGATGACTT AACTGTTACGAATCCTAAGAGAATTGCTATGGCTGCTGAGAAGAAAGCTTGCAACTGCCTGTTACTCAAGGTTAATCAAA TTGGCTCAGTGACTGAATCAATTGATGCGGCTAACTTAGCACGTAAAAATGGATGGGGTGTAATGGTATCGCATCGTTCA GGTGAAACGGAAGATACATTTATCGCTGATCTCGTCGTTGGACTTGCTACCGGACAGATCAAAACTGGAGCACCATGTCG TTCGGAGCGTCTCGCCAAATACAATCAGATACTTCGTATTGAAGAANAACTTGGATCAGCTGCCATTTACGCTGGTCAAA AGTTCCGAAATCCTCAAGCATAGATTATAAATCATTAATATTATCATAAAAGAAAAGAAAACATTTTAATTGAGCGGTAT TTCTTCAGATCTTTACTTTTATCAGTCCTATATTAGTTGTTATGCCATGCAATTACAATAGCTGTCCGCGTTCAGTTCAC TTAAATTAATTTCTTTTAATTTTAAATTATTTATCGTTGTTCTCTATTTGAATCATAGTTCTTAATCATAGTTTTTATAG CTTATCTCGAATCAATTATATCTAAAAATTAAATTTGGTGTTACAGTTAATAAAATGTCTTTTTTTTTAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAGTCTCAATAAATTACCATTAAATAAATGATAATTTTGAAATATTTTTTAAATCTTAACTTTT A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_3906: (37 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217666808488R47601AS3ISA033SLBrugia malayi infective L3 JHU93SL-BmL3
217682808504R47617AS3ISA039SLBrugia malayi infective L3 JHU93SL-BmL3
217785808607R47720AS3ISB111SLBrugia malayi infective L3 JHU93SL-BmL3
217789808611R47724AS3ISB148SLBrugia malayi infective L3 JHU93SL-BmL3
273956878862H14042AS3ISB366SLBrugia malayi infective L3 JHU93SL-BmL3
276425881991H16487AS3ISB292SLBrugia malayi infective L3 JHU93SL-BmL3
281240889997H21302AS3ISB201SLBrugia malayi infective L3 JHU93SL-BmL3
281259890016H21321AS3ISB225SLBrugia malayi infective L3 JHU93SL-BmL3
281263890020H21325AS3ISB233SLBrugia malayi infective L3 JHU93SL-BmL3
291543902075H30919SW3ICA132SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320245945446R86419SWAMCA396SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4427211164869N41271SW3ICA667SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446221167423N43118SW3ICA953SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450751182102N43637SW3ICA806SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451981182225N43697SW3ICA728SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4452271182254N43726SW3ICA1182SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459151182932N44413SW3ICA1283SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4706201215751N64869SW3ICA1332SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304221300172W23318SW3ICA1447SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304871300237W23383SWAMCA709SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7061791592597AA072524SW3ICA1532SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272271634872AA089393SW3ICA1599SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272281634873AA089394SW3ICA1751SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7472121660822AA109352MBAFCE0H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7473021660912AA109272MBAFCE2B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7484651662336AA110589SW3ICA1811SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679541850719AA228600RRAMCA355SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8983241892929AA257453MBAFCZ0B3T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9141491912519AA273145SW3ICA2570SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10482762064923AA406931MBAFCZ7A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10777572130940AA433463SW3ICA2352SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11538402247054AA509177MBAFCX8B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11587872252964AA514147SWMFCA2258SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11918742307116AA545825SWMFCA2324SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11939362315088AA547887MB3D6V2D02T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12617502392946AA585534SW3D9CA112SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13860692660431AA680483SWAMCA3080SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:8:11 on Fri 17 Nov 117.