CBrugiaQ_3916


Sequence

>CBrugiaQ_3916 (8 EST) Length=202 AACCAACTTATTTTTACTTCAACATTTAATGAAGCGCACCCAAAAACACTGAGGTATTTCCATTAATTAGCAACCAATAC AAAGCAAGATCATTAGAAAGAAAAATCAAACATTTGGAAGGAATACGGTAATATAAAGGTCAGGCAACTAGCACGGTTAA ATGCCGATAGAAGTTGATGATAAATCCCCAACAATGCAGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3916: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6462511502081AA032109SWAMCA1412SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6826601549488AA056809SWMFCA734SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6826731549501AA056862SWMFCA859SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7472971660907AA109306MBAFCE2A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003451737728AA161614MBAFCG0H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196191763800AA180608MBAFCG1A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8983251892930AA257454MBAFCZ0B4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10750522113529AA430759SWAMCA1765SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 13:36:55 on Thu 23 Nov 117.