CBrugiaQ_3926


Sequence

>CBrugiaQ_3926 (2 EST) Length=222 GAGTCTCTCTAATTACCCAAGTTTGTAGGGTGGATCGAAATGGTTAACCGTTCGAAAACACGACGAATCATTTTGTGATG GAAAATGCCGTGATCATTACGATGCATAAAGTAACCAATATAAGAAGGGTAAGGAATCAAGACTGGACAGGGCAGGGACG TTATGACTCAACAGAAAGTTGTGACAGCGATTACGAAAGCAACACGAGAATCGTTAGATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3926: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4157011122644H98423KJ4SLB110T3JHU93SL-BmL4 (JHU)
4576361193273N52107KJ4SLB169T3JHU93SL-BmL4 (JHU)


Date: 10:57:31 on Tue 21 Nov 117.