CBrugiaQ_394


Sequence

>CBrugiaQ_394 (4 EST) Length=629 AACAATCACTTGATTATTTATAAACCAGTTAAATTAGAGGATTATATTAAAAACATATCATCACAGGGATTTCATAAAAT TTTTCGGAAATGAATTTTGCAAAGATAATATTAACTGGTATCTTCGGAGCACAAATGGTCGCCCATAATCATATGCTCCA TTCTCTAAAACATGAATTGGACCAGTCTGCTAACCCAAGGATGAATGCGAAAAGATTTGAATAATTAATAAGTGATTGTC TTGCTACTGCACCATTATCAATTTCATGAATGAGACTTTGCTGTGGCTCACAAATGGAATGCCGCTTCTTTAGAGAGGTC AATAATTCCATTAATTTCTTTTCTTTTGTTATTACTGTCGGCTGCATCTTCATGTCCTGTCCACAACATAGCAAACTGGA AGCCCGATGGGTTGTGGACTGTATCTCCATGTCCTGTTCACTAAACGTTCTGCTACAAACCGGACCGGCAGTAATTGCGT TCAATTCATTTGCAAGAAAAATTAAGTGATAAATACTGAATCCACCAAATAATTCCATAATAATTTTCCAGGTGTACATC GTTCTATTTTATATATGTTTTAGAATGCTTACAAAAAGAGTTATAAGCGTTGTCTTTTCCTTCTCNAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_394: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350187988818H48977SWMFCA024SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4446571167458N43156SWMFCA357SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855811876985AA246073SWMFCA1664SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11587932252970AA514153SWMFCA2267SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:21:46 on Thu 23 Nov 117.