CBrugiaQ_3951


Sequence

>CBrugiaQ_3951 (6 EST) Length=229 GAAAATTAGTATGATTTCTTTAAAATCTTTAGCAAGAAATTACCTTTGAATTTTGGCAATGTTTGTTGTTATTACATCGT TATGTTTAATGGAAGTGGTAAAACATTTGTGTTTTCATTAAATTGCCTTGGCTTATGTTTGAAATGTTGGACCGTCATCG ATTATTCGTTTCTTTTGTTGATAAAATTATGATTTTGGAAAAAAAAAAAAAAAAAAAAAAAACCCCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3951: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6806811547244AA054910SWAMCA1498SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7472451660855AA109385MBAFCE1C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196111763792AA180600MBAFCF7H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196721763853AA180661MBAFCG2D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10987802167950AA454281RRAMCA435SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12212502344744AA570854SWMFCA2618SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:17:1 on Mon 20 Nov 117.