CBrugiaQ_3988


Sequence

>CBrugiaQ_3988 (2 EST) Length=195 GGAAGGATGCTGTCAAAAAAAGGCGCTAATGCGAAAACACACTCAGAAGACACTATTTTTGTACAGTATCTCAAACGATT TTTCAGGTTAACTGGCAGAAACGTTGCAGCTAAGCCATATTTCTTCATCTTCATTTGTTTATTTATAACTGTGCTGAGTT CATCCTCTATTTTATTGACTAAAATGACTAACGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3988: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11887412289605AA542693MB4SLY2B10T3Brugia malayi L4 JHU93SL-BmL4
11887812289645AA542733MB4SLY2F08T3Brugia malayi L4 JHU93SL-BmL4


Date: 20:29:37 on Tue 21 Nov 117.