CBrugiaQ_4016


Sequence

>CBrugiaQ_4016 (3 EST) Length=182 TTCGGCTGAAGAAAATGGTCTTAAAAGTAAAATTCGACAGTAGCTTGTTGCATATGTTCCGTAGTGTATTGAATGTGTGT ACTGGTTTTATTTGATAATTGTGCTTCTGCATTTTAAGGTTTGCATGTTTGTTGGGTTCTACAAAATGCTTATTTATCCA TTAATTAAAAATAGCTAATATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_4016: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3918001079819H89389RRAMCA028SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5362401309120W29136RRAMCA1320SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10483572065004AA406986MBAFCZ7H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:7:7 on Mon 20 Nov 117.