CBrugiaQ_4018


Sequence

>CBrugiaQ_4018 (2 EST) Length=188 AGGAATGGTTTCTTTTTCAACATTGTGTCATATTTATAATTTTTTTTTGCACTGGGCGTTATATTTGTGATTATCGGATA TACGATGAATACTGTCGTCTCTTCCGATCTATTATATCCTGATCTTTCCTTCTCTGTCTCTTTCTATATTCTTTAATTGA AGGTTATTTAATAAATGAACTTTGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_4018: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10483282064975AA406892MBAFCZ7E11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11588142252991AA514174SWMFCA2294SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:56:38 on Mon 20 Nov 117.