CBrugiaQ_403


Sequence

>CBrugiaQ_403 (2 EST) Length=605 GTAATGTATACAAGTAATTGGATCCAATGACGCGATTTCAAAGTGGAGTTCGAACTCCACTCAATGTTGCGTTGGTTTCG GACTTCTTTTGCCCAAATGCAGGTGGTGTGGAGACACATATATATTTTCTAGCAAAATGTTTGGTGCAGTTGGGGCATAA AGTGATAGTAATAACTCATGCATACGGCAAACGACGTGGCATTCGATACCTTTCAAATGGACTTAAAGTCTACTACCTAC CGTTCATTGTCATGTATAATGGCAGTTGTCTCCCCTCAATTGTTGGTTCATTGTATTGGTTTCGAAGAATATATTTAGAA GAACATATACAGATAGTACATGGTCATTCTACTTTTTCAACAATGGCACACGAAGCTATGATTCATGCCTGGTGCTTGGG TTTACGCACAACATTCACCGATCATTCTCTCTTCCGGTTCCGCTGATGCATCCGCAATCCCCATGAATAAATTAGTATTG CAGTATTCCCTTGTCAACGTTGAATAGAATTATTTGTGTTTCCTATACAAGTAAAGAAAATACTGTACTGCGAAGTGGTG TTCTTGCAAAATAAAGTTGCAGTTATTCCTAATGCTATTGATACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_403: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675181849748AA228190SWMFCA1112SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8854691876873AA246065SWMFCA1172SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:34:4 on Fri 17 Nov 117.