CBrugiaQ_406


Sequence

>CBrugiaQ_406 (4 EST) Length=607 TTTATTCAAAATCATCGAAAAATGTGAAATTGATTCCAAAAAGCTTCAAAATGTGTATTATAAAAATCATCGAAAATTCT GTATTATGATTGAAAAGTATTTTAAGTTATCATGGAAATTGTTTCGACATCACCAAAAAAGATATTTGAAAAACAGTAGT GCAAAAAATAAAACCACCACTCGACTTTATAGCGACTGTCGCACTTTCAAAATAAAAACAAGGTTATTCGAAAATGATGG TGCGACAAAAAATAAAACCACCATCTGACTTTATAGCGACTGTCGTATTTTCAAAATAAAAATAAGGTTATTCGAAAATA ACGATGCGATGATAAAACCATCACTTAACTTTATTTGCGATTGTCGCACTTAACTCCCCAAAATAAAATAAAAAGCTTAT TCGAAAATGATGGTGCGACAAAAAATAAAACCACCATCTGACTTTATAGCGACTGTCGTATTTTCAAAATAAAAATAAGG TTATTCGAAAATGATGGTGCGACGATAAAACCATCACTTTATTTGCGATTGTCGCATTTAACTTCCCAAAATAAAATAAA AAGCTTATTCGAAAATGATGGTGCGACAAAAAATAAAACCACCATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_406: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473361660946AA109450MBAFCE2E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8856091877013AA246192SWMFCA1712SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8984821893087AA257611MBAFCZ1H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481812064828AA406849MBAFCZ5H03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:22:12 on Fri 24 Nov 117.