CBrugiaQ_41


Sequence

>CBrugiaQ_41 (9 EST) Length=876 GCCACCAAAATCCGTTCATTTTTAACGGTTTTATTTTCCAATCCCAATTTAACAAGTCCAATGCAGAAAAACCAGTAGGA TTGGGAGATGCCAGGCATGAAAATTGTGCCACCCAAAGTAAACAGGGGTTTCCTTCATTTAATTCCAACAACATAGNGTT ACCGTCCTTTCCGCCNGAAGCAACAAAGGGACCATCCGGNGAAACAGTAANTGGGTTGANGTATCCAGGGTGTCCGATAT GATTGTTTTCAGCTTAACAGTTAGCAAGATTCCATACCTTCACAATTTTGTCCCATCCGGCGGAAACAATTACAGGGTTT GAACTTGAAGGTGAAAAACGTACATTTGAAACCCAATCAGTGTGGCAGTCTTCGCTAACTGTATATTTGCACTGAGCTAA AGTGTTCCACAGTTTGATCGTTTTATCCCGTGATCCCGACACGATCTGTCGATTGTCAGCAGAGAATGCGACAGATAATA CGTCCTTTGTATGTGAAACAAACTGCCTTGATGTTACACCTGTAGTGAGGTCCCAGAGTCGCAATGTTTTGTCCCATGAA CCAGAAAGAGCGAACTGTCCATCGGAAGACATCACAACATCAGAAACAAAGTGACCGTGGCCCTTCAATGCTCTTTCAGC TTTTCCACCTAACTGAACGCCATAATTTCCTGACATATCATCCGCATCCAATTTCCACACAATTATTGTTTTATCTCGAG AAGACGAAATAATCATATTCGGGTAACGAGCATTTGTAGCTATTTGTGTCACCCATCCATTGTGACCTTTCAAAGTCCCT TTTAACTGCATTTGTTCTGCCATTGTTGTCTAATTCTTCACACAAGCTGTAGAATACTTGAAGTCTCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_41: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811851237155N74846SW3ICA1413SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5077021272186W00771SWAMCA575SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8675221849752AA228194SWMFCA1117SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8809251870909AA241617MBL2SJ2C2T3Brugia malayi second stage larvae JHU96SL-BmL2
9141161912486AA273112SWMFCA1955SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11293502213939AA484720SWMFCA2095SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12213152345212AA570919SWMFCA2747SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12617712392967AA585555SW3D9CA146SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13870822663022AA681017SW3D9CA551SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 8:20:30 on Fri 24 Nov 117.