CBrugiaQ_4116


Sequence

>CBrugiaQ_4116 (2 EST) Length=167 AATTCTTGTAATGCTAACATTGCATTGCTGTTCACTGTAACACCATCACCGCCAGTACTTCCACCACTTTCATTCTGTTC ATTATCGTCGGGATCGGATGGTACATATTCTTCGTCATCTTCCGAATCACTTTCTTCATCATTGTTACCAGACATTAGTC TATTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_4116: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281251890008H21313AS3ISB261SLBrugia malayi infective L3 JHU93SL-BmL3
8810281871012AA241707MBL2SJ8F6T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 17:40:39 on Mon 20 Nov 117.