CBrugiaQ_417


Sequence

>CBrugiaQ_417 (3 EST) Length=602 GTTTGAGGTATTTCTTGGATTGTAGCTGAATTGGATTTATAGCGCTCAACATATGGAGGATGACTGGATGCACTGTGTGG ACCGTCTCTTAAAGGCATGGACAGGATATCAGTTGGGGGTACAGATGCTTTCCGGTGGACCAGAAACATATCAAAAGGCT GAGTGGTTTGCTAAGGTTCTGGCCGAGTATACATCCAGCTCAGGGAATCTACAAGTTCATAACTTAAGTGAATGGATATG TGACATTTTGGATAACGAGTTTAATCTTATTCTAAAGGATAACAGCATCGAGTGGCTTGCTTCATCTCTGCTAAAGTGTA GGTTGTGGTTGGAAAAATGTCAGAAACCAGAATTTGAAAATTTCCTATCCAAGTTGCCGTCCGAAAGTGCCGTACGAGCT GCTGCAATAGAAAGTGAAGTGGTAATGGACCACTCAGATGACGAAAACAGTGACTGTGAGAAATTTGAGAATAAGCCGCA AGACAAACAAACTAAAAGGTCATCGAAGGAAACCCATGGAAACCGATGAAGAATGGTTGGACTACAGTTATTCCGTAAAT AACTCACCGTTTTTGTTTTTGTCTAATAAAAACTCCGAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_417: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639331845381AA224597SWMFCA1021SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8983061892911AA257409MB4SLM2H8T3Brugia malayi L4 JHU93SL-BmL4
12354472369542AA584989SWMFCA2807SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:54:58 on Fri 24 Nov 117.