CBrugiaQ_4177


Sequence

>CBrugiaQ_4177 (2 EST) Length=270 CATAAGTACATATTTAAATAAATTCTTTCTTTTTTTGAAGAGACAAAAATTGAATTATTTGTATGGAAAAGAAGTTTGAT CATTCAATTATATACATTATTCTTTGATATGATTGATGACAGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CCTCTGTTATGTGAACTGANAGTAGAACAAAAACGAGANATTTAGATGTGGCCACNTCTNACATATACCTGNGAGATTGG GGAANTAGAACAGATTAATATGTTNTCCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_4177: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676271537107AA051940SWMFCA825SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7473051660915AA109275MBAFCE2B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:34:14 on Fri 17 Nov 117.