CBrugiaQ_4183


Sequence

>CBrugiaQ_4183 (2 EST) Length=234 TGACATCTGGAACGTGCTTGATCATAGTGAACAATGGTACACTAACTGGTTGACCCGTTGACCCTTCACATCTTTCCTTT ACCATTAAAAATATGCATTTCCAACCTTTAACTTCCATTTGGCCAATTTCATTGTCTTTGTTTATCTCAAACTTGGGTAA TTAAACCCGGAATTCCGGGTTTAATTATCCAAGTTTGAGGAGAACAATAAACGGGAAATACCGTGATATAGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4183: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958741442865N89535KJ4SLB222T3JHU93SL-BmL4 (JHU)
8988081893413AA257638MBL2SJ4H12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 14:55:19 on Sun 19 Nov 117.