CBrugiaQ_4184


Sequence

>CBrugiaQ_4184 (2 EST) Length=156 ATTTTAAGTCTTCTAAAGTCGGTAAAAGCATCTTCCCTCATGTTTCGGAAAAAAAGTGATTGGGGTGGACCGACTTTTTC GTGCTTTTGCTACTTGTTACTCTTTTTTTGTGATGTTATGTGCAACTGATTTCTATACATAATAAAATTGATTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4184: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197551763936AA180718MBAFCG3G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10774752125779AA433181RRAMCA1628SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 18:23:9 on Sat 18 Nov 117.