CBrugiaQ_419


Sequence

>CBrugiaQ_419 (2 EST) Length=622 GGATCTCCCCTTTAGGATTTTCAAGTAGGGTTCTAGCCTCAAATGTTGTAAGGCATATCTGTTGCCTTATGTCCCGTAAT AAACTCGCCAACGCAAACCCAATATAGTAAATCCGGAGTTTGGCTTTCGCCAAAATTAGTTGGGAAATGTAAGCTGAGAT GCGTTATATTTGAGAATTTTGAGGCTTTTATGGGATAATCTATTTGTGCATTCATGTCCTGCTTCAGTGGAAATTCTTTG ATCAAGACTCTAAAGTCGTTGCTTCAAATGACATTGATGGTCGATCTTTGTAAAGACGTATGTATGATGGATGAGTACCA TCCAAGTCGCCAGACAGCACAAGACCAGTTATTTTCACATGTCCTTTGAATGGTACATTAAACAACAGCTCTTCATCAAG GTCGCTTGCTACATAAATGGTCCTGTCCAATCGATCCTCCCATTTCTTGAAAATCTTTGCGCCAGAACCTTCAACTGCTT CATTCAGTACTATTACCTTTTGGAGATCAATGTGAGAGTTGATTGTATAACGCATCCCCTCGTTTTTTCGCTCAAAATTA ACTGCTTCATTTTCACAATGAAAGTTAGAACCCATAACGCTCGTGCCGAATCCTGCACCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_419: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217604808426R47539SW3ICA104SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8675641849794AA228223SWMFCA1262SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:59:15 on Wed 22 Nov 117.